Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117753 |
| Name | oriT_Res13-Abat-PEB01-P1-04-A|unnamednovel_2  |
| Organism | Raoultella terrigena strain Res13-Abat-PEB01-P1-04-A |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP062918 (2470..2521 [-], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 8..14, 17..23 (CAAAATT..AATTTTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_Res13-Abat-PEB01-P1-04-A|unnamednovel_2
AAATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AAATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18186 | GenBank | NZ_CP062918 |
| Plasmid name | Res13-Abat-PEB01-P1-04-A|unnamednovel_2 | Incompatibility group | Col440I |
| Plasmid size | 3505 bp | Coordinate of oriT [Strand] | 2470..2521 [-] |
| Host baterium | Raoultella terrigena strain Res13-Abat-PEB01-P1-04-A |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |