Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117750 |
| Name | oriT_KPN029|unnamed4  |
| Organism | Klebsiella variicola strain KPN029 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP065166 (4621..4671 [+], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_KPN029|unnamed4
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18183 | GenBank | NZ_CP065166 |
| Plasmid name | KPN029|unnamed4 | Incompatibility group | Col440I |
| Plasmid size | 5783 bp | Coordinate of oriT [Strand] | 4621..4671 [+] |
| Host baterium | Klebsiella variicola strain KPN029 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |