Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117676 |
| Name | oriT_pmS1O1-GES24  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain mS1O1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LC589061 (9743..9793 [+], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pmS1O1-GES24
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18109 | GenBank | NZ_LC589061 |
| Plasmid name | pmS1O1-GES24 | Incompatibility group | Col440I |
| Plasmid size | 31970 bp | Coordinate of oriT [Strand] | 9743..9793 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain mS1O1 |
Cargo genes
| Drug resistance gene | blaGES-4, catB3 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |