Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 117665
• Name: oriT_S17BD05200|unnamed4
• Organism: Shigella sonnei strain S17BD05200
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP110408 (1189..1263 [+], 75 nt)
• oriT length: 75 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 75 nt

>oriT_S17BD05200|unnamed4
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 18098
• GenBank: NZ_CP110408
• Plasmid name: S17BD05200|unnamed4
• Incompatibility group: ColRNAI
• Plasmid size: 2690 bp
• Coordinate of oriT [Strand]: 1189..1263 [+]
• Host baterium: Shigella sonnei strain S17BD05200

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -