Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117664
Name   oriT_S17BD05200|unnamed1 in_silico
Organism   Shigella sonnei strain S17BD05200
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP110405 (4846..4905 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_S17BD05200|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18097 GenBank   NZ_CP110405
Plasmid name   S17BD05200|unnamed1 Incompatibility group   ColRNAI
Plasmid size   8401 bp Coordinate of oriT [Strand]   4846..4905 [+]
Host baterium   Shigella sonnei strain S17BD05200

Cargo genes


Drug resistance gene   tet(A), sul2, aph(3'')-Ib
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -