Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117659 |
| Name | oriT_pYH12207-9  |
| Organism | Acinetobacter piscicola strain YH12207_T |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP048668 (6488..6523 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 1..6, 11..16 (CTTTAC..GTAAAG) |
| Location of nic site | 25..26 |
| Conserved sequence flanking the nic site |
GTGTGTTATA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pYH12207-9
CTTTACGAATGTAAAGTATAGTGTGTTATACTTTAC
CTTTACGAATGTAAAGTATAGTGTGTTATACTTTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18092 | GenBank | NZ_CP048668 |
| Plasmid name | pYH12207-9 | Incompatibility group | - |
| Plasmid size | 7423 bp | Coordinate of oriT [Strand] | 6488..6523 [+] |
| Host baterium | Acinetobacter piscicola strain YH12207_T |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |