Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117646 |
| Name | oriT_pYH12138-2  |
| Organism | Acinetobacter sp. YH12138 strain YH12138_T |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP048672 (101403..101506 [-], 104 nt) |
| oriT length | 104 nt |
| IRs (inverted repeats) | 63..70, 73..80 (CACCATGC..GCATGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 104 nt
>oriT_pYH12138-2
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18079 | GenBank | NZ_CP048672 |
| Plasmid name | pYH12138-2 | Incompatibility group | - |
| Plasmid size | 105038 bp | Coordinate of oriT [Strand] | 101403..101506 [-] |
| Host baterium | Acinetobacter sp. YH12138 strain YH12138_T |
Cargo genes
| Drug resistance gene | aph(3'')-Ib, aph(6)-Id, tet(Y), aph(3')-Ia, sul2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |