Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117618 |
| Name | oriT_pWP5-S18-ESBL-05_14  |
| Organism | Klebsiella quasipneumoniae strain WP5-S18-ESBL-05 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP022156 (500..557 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pWP5-S18-ESBL-05_14
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18051 | GenBank | NZ_AP022156 |
| Plasmid name | pWP5-S18-ESBL-05_14 | Incompatibility group | ColRNAI |
| Plasmid size | 2203 bp | Coordinate of oriT [Strand] | 500..557 [+] |
| Host baterium | Klebsiella quasipneumoniae strain WP5-S18-ESBL-05 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |