Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117611 |
| Name | oriT_pWP5-S18-ESBL-05_3  |
| Organism | Klebsiella quasipneumoniae strain WP5-S18-ESBL-05 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP022145 (2043..2147 [-], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 46..51, 56..61 (ATTCCA..TGGAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_pWP5-S18-ESBL-05_3
AAATTGACAAATTCCAAACATGGGTTAGCCTAGTGACAAAACTAGATTCCAATAGTGGAATAATTAGGTTTAGATTCCAGATAGATAGTTATGTGGATAGGAATT
AAATTGACAAATTCCAAACATGGGTTAGCCTAGTGACAAAACTAGATTCCAATAGTGGAATAATTAGGTTTAGATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18044 | GenBank | NZ_AP022145 |
| Plasmid name | pWP5-S18-ESBL-05_3 | Incompatibility group | IncA/C |
| Plasmid size | 161135 bp | Coordinate of oriT [Strand] | 2043..2147 [-] |
| Host baterium | Klebsiella quasipneumoniae strain WP5-S18-ESBL-05 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | merP, merT, merR2, arsR, arsD, arsA, arsB, arsC |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |