Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117602 |
| Name | oriT_pSTW0522-39-3  |
| Organism | Klebsiella quasipneumoniae strain STW0522-39 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP022415 (4313..4364 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 6..14, 17..25 (CGCAAAATT..AATTTTGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pSTW0522-39-3
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18035 | GenBank | NZ_AP022415 |
| Plasmid name | pSTW0522-39-3 | Incompatibility group | ColRNAI |
| Plasmid size | 6423 bp | Coordinate of oriT [Strand] | 4313..4364 [+] |
| Host baterium | Klebsiella quasipneumoniae strain STW0522-39 |
Cargo genes
| Drug resistance gene | blaCTX-M-2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |