Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117588 |
| Name | oriT_pWP5-W18-ESBL-06_6  |
| Organism | Klebsiella quasipneumoniae strain WP5-W18-ESBL-06 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP022118 (4829..4887 [+], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pWP5-W18-ESBL-06_6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTGTACTGGCTT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTGTACTGGCTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18021 | GenBank | NZ_AP022118 |
| Plasmid name | pWP5-W18-ESBL-06_6 | Incompatibility group | ColRNAI |
| Plasmid size | 5714 bp | Coordinate of oriT [Strand] | 4829..4887 [+] |
| Host baterium | Klebsiella quasipneumoniae strain WP5-W18-ESBL-06 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |