Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117575
Name   oriT_pWP3-W18-ESBL-02_7 in_silico
Organism   Klebsiella sp. WP3-W18-ESBL-02
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP021979 (2025..2084 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pWP3-W18-ESBL-02_7
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18008 GenBank   NZ_AP021979
Plasmid name   pWP3-W18-ESBL-02_7 Incompatibility group   Col440II
Plasmid size   4667 bp Coordinate of oriT [Strand]   2025..2084 [+]
Host baterium   Klebsiella sp. WP3-W18-ESBL-02

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -