Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117464 |
| Name | oriT_pKAM546_11 |
| Organism | Enterobacter roggenkampii strain KAM546 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP026884 (2074..2257 [+], 184 nt) |
| oriT length | 184 nt |
| IRs (inverted repeats) | 105..110, 115..120 (ACCCCC..GGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 184 nt
>oriT_pKAM546_11
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTATGGGTAAAGCGAAGCGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTATGGGTAAAGCGAAGCGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17897 | GenBank | NZ_AP026884 |
| Plasmid name | pKAM546_11 | Incompatibility group | Col |
| Plasmid size | 2307 bp | Coordinate of oriT [Strand] | 2074..2257 [+] |
| Host baterium | Enterobacter roggenkampii strain KAM546 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |