Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117461 |
| Name | oriT_pKAM546_1  |
| Organism | Enterobacter roggenkampii strain KAM546 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP026874 (137398..137497 [+], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 78..83, 90..95 (AAAAAA..TTTTTT) 78..83, 89..94 (AAAAAA..TTTTTT) 32..39, 42..49 (AGCGTGAT..ATCACGCT) 27..32, 41..46 (GTGATA..TATCAC) 18..24, 36..42 (TAAATCA..TGATTTA) |
| Location of nic site | 60..61 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_pKAM546_1
ATTTTGTTTTTTCCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
ATTTTGTTTTTTCCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17894 | GenBank | NZ_AP026874 |
| Plasmid name | pKAM546_1 | Incompatibility group | IncFIB |
| Plasmid size | 139510 bp | Coordinate of oriT [Strand] | 137398..137497 [+] |
| Host baterium | Enterobacter roggenkampii strain KAM546 |
Cargo genes
| Drug resistance gene | mcr-10 |
| Virulence gene | mrkF, mrkC, mrkB, mrkA |
| Metal resistance gene | silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |