Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117400 |
| Name | oriT_pTH114-1  |
| Organism | Klebsiella quasipneumoniae strain TH114 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP035209 (71560..71658 [+], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pTH114-1
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17833 | GenBank | NZ_CP035209 |
| Plasmid name | pTH114-1 | Incompatibility group | IncR |
| Plasmid size | 73414 bp | Coordinate of oriT [Strand] | 71560..71658 [+] |
| Host baterium | Klebsiella quasipneumoniae strain TH114 |
Cargo genes
| Drug resistance gene | dfrA12, aadA2, floR, sul2, blaTEM-1B, tet(A) |
| Virulence gene | - |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |