Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117350 |
| Name | oriT_p4_010005  |
| Organism | Acinetobacter chinensis strain WCHAc010005 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP032130 (534..569 [-], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 5..11, 15..21 (GCAAACT..AGTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_p4_010005
CACGGCAAACTGAAAGTTTGCATAAGTGCGCCATTA
CACGGCAAACTGAAAGTTTGCATAAGTGCGCCATTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17783 | GenBank | NZ_CP032130 |
| Plasmid name | p4_010005 | Incompatibility group | - |
| Plasmid size | 1398 bp | Coordinate of oriT [Strand] | 534..569 [-] |
| Host baterium | Acinetobacter chinensis strain WCHAc010005 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |