Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117347 |
| Name | oriT_pD120-1_3kb |
| Organism | Klebsiella quasipneumoniae strain D120-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP034680 (2948..2998 [-], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pD120-1_3kb
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGA
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17780 | GenBank | NZ_CP034680 |
| Plasmid name | pD120-1_3kb | Incompatibility group | Col440I |
| Plasmid size | 3897 bp | Coordinate of oriT [Strand] | 2948..2998 [-] |
| Host baterium | Klebsiella quasipneumoniae strain D120-1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |