Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117346 |
| Name | oriT_pD120-1_80kb  |
| Organism | Klebsiella quasipneumoniae strain D120-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP034677 (60296..60390 [+], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pD120-1_80kb
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17779 | GenBank | NZ_CP034677 |
| Plasmid name | pD120-1_80kb | Incompatibility group | IncR |
| Plasmid size | 80476 bp | Coordinate of oriT [Strand] | 60296..60390 [+] |
| Host baterium | Klebsiella quasipneumoniae strain D120-1 |
Cargo genes
| Drug resistance gene | tet(D), qnrS1, blaLAP-2, catA2, dfrA14, aph(6)-Id, aph(3'')-Ib, sul2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |