Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 117342 |
Name | oriT_pG4584_3.7Kb |
Organism | Klebsiella quasipneumoniae strain G4584 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP034135 (2571..2621 [+], 51 nt) |
oriT length | 51 nt |
IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pG4584_3.7Kb
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 17775 | GenBank | NZ_CP034135 |
Plasmid name | pG4584_3.7Kb | Incompatibility group | Col440I |
Plasmid size | 3733 bp | Coordinate of oriT [Strand] | 2571..2621 [+] |
Host baterium | Klebsiella quasipneumoniae strain G4584 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |