Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117339 |
| Name | oriT_pG747_3.7Kb  |
| Organism | Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP034339 (2571..2621 [+], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pG747_3.7Kb
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17772 | GenBank | NZ_CP034339 |
| Plasmid name | pG747_3.7Kb | Incompatibility group | Col440I |
| Plasmid size | 3733 bp | Coordinate of oriT [Strand] | 2571..2621 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |