Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117118
Name   oriT_PNUSAE076676|unnamed5 in_silico
Organism   Shigella flexneri strain PNUSAE076676
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP138851 (1716..2001 [-], 286 nt)
oriT length   286 nt
IRs (inverted repeats)      247..252, 255..260  (CGCCCC..GGGGCG)
 130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..38, 41..48  (GCAAAAAC..GTTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 286 nt

>oriT_PNUSAE076676|unnamed5
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAAAACATTATCTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17551 GenBank   NZ_CP138851
Plasmid name   PNUSAE076676|unnamed5 Incompatibility group   ColRNAI
Plasmid size   3181 bp Coordinate of oriT [Strand]   1716..2001 [-]
Host baterium   Shigella flexneri strain PNUSAE076676

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -