Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117089 |
| Name | oriT_86|unnamed2  |
| Organism | Klebsiella oxytoca strain 86 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP138759 (36503..36601 [+], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_86|unnamed2
TTTGTTTTTTTTCTTTTAAATCAGTGCAATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCAATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17522 | GenBank | NZ_CP138759 |
| Plasmid name | 86|unnamed2 | Incompatibility group | IncR |
| Plasmid size | 94397 bp | Coordinate of oriT [Strand] | 36503..36601 [+] |
| Host baterium | Klebsiella oxytoca strain 86 |
Cargo genes
| Drug resistance gene | catA2, sul2, aph(3'')-Ib, aph(6)-Id, blaTEM-1B, aac(3)-IId, qnrS1, aac(6')-Ib-cr, ARR-3, dfrA27, aadA16, qacE, sul1, mph(A), tet(A), floR |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |