Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116997
Name   oriT_pT17-1-poxtA-53k in_silico
Organism   Enterococcus faecium strain T17-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP109838 (1031..1068 [+], 38 nt)
oriT length   38 nt
IRs (inverted repeats)      14..22, 29..37  (TAAAGTATA..TATACTTTA)
 2..8, 13..19  (ACTTTAT..ATAAAGT)
Location of nic site      27..28
Conserved sequence flanking the
  nic site  
 
 GTGTGTTATA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 38 nt

>oriT_pT17-1-poxtA-53k
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17430 GenBank   NZ_CP109838
Plasmid name   pT17-1-poxtA-53k Incompatibility group   -
Plasmid size   53378 bp Coordinate of oriT [Strand]   1031..1068 [+]
Host baterium   Enterococcus faecium strain T17-1

Cargo genes


Drug resistance gene   fexB, poxtA, erm(B), vat(E), dfrG, tet(M)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -