Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116997 |
| Name | oriT_pT17-1-poxtA-53k  |
| Organism | Enterococcus faecium strain T17-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP109838 (1031..1068 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 14..22, 29..37 (TAAAGTATA..TATACTTTA) 2..8, 13..19 (ACTTTAT..ATAAAGT) |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
GTGTGTTATA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pT17-1-poxtA-53k
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17430 | GenBank | NZ_CP109838 |
| Plasmid name | pT17-1-poxtA-53k | Incompatibility group | - |
| Plasmid size | 53378 bp | Coordinate of oriT [Strand] | 1031..1068 [+] |
| Host baterium | Enterococcus faecium strain T17-1 |
Cargo genes
| Drug resistance gene | fexB, poxtA, erm(B), vat(E), dfrG, tet(M) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |