Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 116962 |
Name | oriT_pST20130940 |
Organism | Staphylococcus aureus strain ST20130940 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP012980 (4321..4509 [+], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 163..168, 178..183 (ATTTTA..TAAAAT) 118..123, 130..135 (CCCCAT..ATGGGG) 100..106, 110..116 (ATCTGGC..GCCAGAT) 41..46, 48..53 (AAGTGT..ACACTT) 31..39, 44..52 (AGTGTCACA..TGTGACACT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pST20130940
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 17395 | GenBank | NZ_CP012980 |
Plasmid name | pST20130940 | Incompatibility group | - |
Plasmid size | 20720 bp | Coordinate of oriT [Strand] | 4321..4509 [+] |
Host baterium | Staphylococcus aureus strain ST20130940 |
Cargo genes
Drug resistance gene | blaZ |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |