Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116959
Name   oriT_pSATU135_2 in_silico
Organism   Staphylococcus aureus strain SATU135
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP138457 (3880..4057 [+], 178 nt)
oriT length   178 nt
IRs (inverted repeats)      152..157, 167..172  (ATTTTA..TAAAAT)
 107..112, 119..124  (CCCCAT..ATGGGG)
 89..95, 99..105  (ATCTGGC..GCCAGAT)
 44..51, 64..71  (GTCTTTTT..AAAAAGAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 178 nt

>oriT_pSATU135_2
TGTGACAAACGCAATATATTGTGTCGCAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17392 GenBank   NZ_CP138457
Plasmid name   pSATU135_2 Incompatibility group   -
Plasmid size   34991 bp Coordinate of oriT [Strand]   3880..4057 [+]
Host baterium   Staphylococcus aureus strain SATU135

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   mco, arsR, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21