Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116929 |
| Name | oriT_FDAARGOS_1502|unnamed2  |
| Organism | UNVERIFIED_ORG: Hafnia paralvei strain FDAARGOS_1502 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084666 (989..1048 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_FDAARGOS_1502|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGTAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGTAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17362 | GenBank | NZ_CP084666 |
| Plasmid name | FDAARGOS_1502|unnamed2 | Incompatibility group | - |
| Plasmid size | 5113 bp | Coordinate of oriT [Strand] | 989..1048 [-] |
| Host baterium | UNVERIFIED_ORG: Hafnia paralvei strain FDAARGOS_1502 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |