Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 116908
• Name: oriT_pA
• Organism: Salmonella sp. A29-2
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP083732 (3483..3542 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 17341
• GenBank: NZ_CP083732
• Plasmid name: pA
• Incompatibility group: ColRNAI
• Plasmid size: 5430 bp
• Coordinate of oriT [Strand]: 3483..3542 [-]
• Host baterium: Salmonella sp. A29-2

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -