Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116863 |
| Name | oriT_BB1502_3 |
| Organism | Klebsiella quasipneumoniae isolate BB1502 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OV754001 (4070..4229 [-], 160 nt) |
| oriT length | 160 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 160 nt
>oriT_BB1502_3
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 17296 | GenBank | NZ_OV754001 |
| Plasmid name | BB1502_3 | Incompatibility group | IncQ1 |
| Plasmid size | 6947 bp | Coordinate of oriT [Strand] | 4070..4229 [-] |
| Host baterium | Klebsiella quasipneumoniae isolate BB1502 |
Cargo genes
| Drug resistance gene | blaCMY-4 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |