Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116861 |
| Name | oriT_BB1502_1  |
| Organism | Klebsiella quasipneumoniae isolate BB1502 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OV753998 (173686..173734 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_BB1502_1
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 173128..197185
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| O1Y77_RS27125 (VKR_05429) | 170697..171096 | + | 400 | Protein_187 | hypothetical protein | - |
| O1Y77_RS27130 (VKR_05430) | 171912..172733 | + | 822 | WP_032454971 | DUF932 domain-containing protein | - |
| O1Y77_RS27135 | 172766..173095 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| O1Y77_RS27140 (VKR_05431) | 173128..173613 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| O1Y77_RS27145 (VKR_05432) | 174045..174437 | + | 393 | WP_020805752 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| O1Y77_RS27150 (VKR_05433) | 174675..175379 | + | 705 | WP_050442685 | hypothetical protein | - |
| O1Y77_RS27155 | 175463..175663 | + | 201 | WP_050442686 | TraY domain-containing protein | - |
| O1Y77_RS27160 (VKR_05434) | 175732..176100 | + | 369 | WP_020316649 | type IV conjugative transfer system pilin TraA | - |
| O1Y77_RS27165 (VKR_05435) | 176114..176419 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| O1Y77_RS27170 (VKR_05436) | 176439..177005 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| O1Y77_RS27175 (VKR_05437) | 176992..177732 | + | 741 | WP_013214019 | type-F conjugative transfer system secretin TraK | traK |
| O1Y77_RS27180 (VKR_05438) | 177732..179156 | + | 1425 | WP_023284634 | F-type conjugal transfer pilus assembly protein TraB | traB |
| O1Y77_RS27185 (VKR_05439) | 179270..179854 | + | 585 | WP_032441881 | type IV conjugative transfer system lipoprotein TraV | traV |
| O1Y77_RS27190 (VKR_05440) | 179986..180396 | + | 411 | WP_267668008 | hypothetical protein | - |
| O1Y77_RS27195 (VKR_05441) | 180502..180720 | + | 219 | WP_004195235 | hypothetical protein | - |
| O1Y77_RS27200 (VKR_05442) | 180721..181032 | + | 312 | WP_004195240 | hypothetical protein | - |
| O1Y77_RS27205 (VKR_05443) | 181099..181503 | + | 405 | WP_004197817 | hypothetical protein | - |
| O1Y77_RS27210 (VKR_05445) | 181881..182279 | + | 399 | WP_074184101 | hypothetical protein | - |
| O1Y77_RS27215 (VKR_05446) | 182351..184993 | + | 2643 | WP_032454974 | type IV secretion system protein TraC | virb4 |
| O1Y77_RS27220 (VKR_05447) | 184990..185379 | + | 390 | WP_004167468 | type-F conjugative transfer system protein TrbI | - |
| O1Y77_RS27225 (VKR_05448) | 185379..186005 | + | 627 | WP_004152507 | type-F conjugative transfer system protein TraW | traW |
| O1Y77_RS27230 (VKR_05449) | 186047..186436 | + | 390 | WP_004194992 | hypothetical protein | - |
| O1Y77_RS27235 (VKR_05450) | 186433..187422 | + | 990 | WP_009309872 | conjugal transfer pilus assembly protein TraU | traU |
| O1Y77_RS27240 (VKR_05451) | 187435..188073 | + | 639 | WP_004193871 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| O1Y77_RS27245 (VKR_05452) | 188132..190087 | + | 1956 | WP_009309873 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| O1Y77_RS27250 (VKR_05453) | 190119..190373 | + | 255 | WP_004195500 | conjugal transfer protein TrbE | - |
| O1Y77_RS27255 (VKR_05454) | 190351..190599 | + | 249 | WP_004152675 | hypothetical protein | - |
| O1Y77_RS27260 (VKR_05455) | 190612..190938 | + | 327 | WP_004194451 | hypothetical protein | - |
| O1Y77_RS27265 (VKR_05456) | 190959..191711 | + | 753 | WP_009309874 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| O1Y77_RS27270 (VKR_05457) | 191722..191961 | + | 240 | WP_009309875 | type-F conjugative transfer system pilin chaperone TraQ | - |
| O1Y77_RS27275 (VKR_05458) | 191933..192490 | + | 558 | WP_032454975 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| O1Y77_RS27280 (VKR_05459) | 192536..192979 | + | 444 | WP_032454976 | F-type conjugal transfer protein TrbF | - |
| O1Y77_RS27285 (VKR_05460) | 192957..194336 | + | 1380 | WP_267668006 | conjugal transfer pilus assembly protein TraH | traH |
| O1Y77_RS27290 (VKR_05461) | 194336..197185 | + | 2850 | WP_013609534 | conjugal transfer mating-pair stabilization protein TraG | traG |
| O1Y77_RS27295 (VKR_05462) | 197188..197721 | + | 534 | WP_014343486 | conjugal transfer protein TraS | - |
Host bacterium
| ID | 17294 | GenBank | NZ_OV753998 |
| Plasmid name | BB1502_1 | Incompatibility group | IncFII |
| Plasmid size | 198008 bp | Coordinate of oriT [Strand] | 173686..173734 [-] |
| Host baterium | Klebsiella quasipneumoniae isolate BB1502 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsB, arsC, pcoE, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |