Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116835
Name   oriT_JXY0409-18|unnamed4 in_silico
Organism   Salmonella sp. JXY0409-18
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP084220 (3371..3428 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_JXY0409-18|unnamed4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17268 GenBank   NZ_CP084220
Plasmid name   JXY0409-18|unnamed4 Incompatibility group   -
Plasmid size   3428 bp Coordinate of oriT [Strand]   3371..3428 [+]
Host baterium   Salmonella sp. JXY0409-18

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -