Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 116835
• Name: oriT_JXY0409-18|unnamed4
• Organism: Salmonella sp. JXY0409-18
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP084220 (3371..3428 [+], 58 nt)
• oriT length: 58 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 58 nt

>oriT_JXY0409-18|unnamed4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 17268
• GenBank: NZ_CP084220
• Plasmid name: JXY0409-18|unnamed4
• Incompatibility group: -
• Plasmid size: 3428 bp
• Coordinate of oriT [Strand]: 3371..3428 [+]
• Host baterium: Salmonella sp. JXY0409-18

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -