Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116805
Name   oriT_FDAARGOS_1|unnamed1 in_silico
Organism   Staphylococcus aureus strain FDAARGOS_1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP026969 (6639..6823 [+], 185 nt)
oriT length   185 nt
IRs (inverted repeats)      113..119, 126..132  (TCCCCAT..ATGGGGA)
 96..102, 106..112  (ATCTGGC..GCCAGAT)
 54..61, 68..75  (TTTTTATG..CATAAAAA)
 29..35, 40..46  (TGTCACA..TGTGACA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 185 nt

>oriT_FDAARGOS_1|unnamed1
TGTCTTATTTTTGTGACACAATATATTGTGTCACAAAAGTGTGACATTGGAGCTTTTTATGACCCCACATAAAAACATCTCGGATGTCTTGAAATATCTGGCTTTGCCAGATTCCCCATTCGTTGATGGGGACAAATTCCTCTTATGCTCTTACGGAGTTTTTAGGGATAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17238 GenBank   NZ_CP026969
Plasmid name   FDAARGOS_1|unnamed1 Incompatibility group   -
Plasmid size   9124 bp Coordinate of oriT [Strand]   6639..6823 [+]
Host baterium   Staphylococcus aureus strain FDAARGOS_1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21