Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116778
Name   oriT_pUR-EC3.1 in_silico
Organism   Enterobacter cloacae subsp. cloacae strain ODC_Eclo3
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MZ382870 (4523..4682 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pUR-EC3.1
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17211 GenBank   NZ_MZ382870
Plasmid name   pUR-EC3.1 Incompatibility group   IncQ1
Plasmid size   7400 bp Coordinate of oriT [Strand]   4523..4682 [-]
Host baterium   Enterobacter cloacae subsp. cloacae strain ODC_Eclo3

Cargo genes


Drug resistance gene   rmtG
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -