Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116774
Name   oriT_pLP5403 in_silico
Organism   Lacticaseibacillus paracasei
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_021574 (78..115 [+], 38 nt)
oriT length   38 nt
IRs (inverted repeats)      1..6, 20..25  (ACACCA..TGGTGT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 38 nt

>oriT_pLP5403
ACACCATCAATTTTAATTGTGGTGTGTAAGTGCGCATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17207 GenBank   NC_021574
Plasmid name   pLP5403 Incompatibility group   -
Plasmid size   1788 bp Coordinate of oriT [Strand]   78..115 [+]
Host baterium   Lacticaseibacillus paracasei

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -