Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116768 |
| Name | oriT_p24150-KPC  |
| Organism | Raoultella ornithinolytica strain 24150 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MZ726784 (56951..57000 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_p24150-KPC
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 56393..75081
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NIS64_RS00305 | 51495..51845 | + | 351 | WP_004153414 | hypothetical protein | - |
| NIS64_RS00310 | 52475..52828 | + | 354 | WP_004152748 | hypothetical protein | - |
| NIS64_RS00315 | 52885..53232 | + | 348 | WP_004152749 | hypothetical protein | - |
| NIS64_RS00320 | 53327..53473 | + | 147 | WP_004152750 | hypothetical protein | - |
| NIS64_RS00325 | 53524..54357 | + | 834 | WP_004152751 | N-6 DNA methylase | - |
| NIS64_RS00525 | 54439..54564 | - | 126 | WP_257792838 | hypothetical protein | - |
| NIS64_RS00330 | 55177..55998 | + | 822 | WP_004152492 | DUF932 domain-containing protein | - |
| NIS64_RS00335 | 56031..56360 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| NIS64_RS00340 | 56393..56878 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| NIS64_RS00345 | 57312..57704 | + | 393 | WP_053390193 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| NIS64_RS00350 | 57943..58617 | + | 675 | WP_075606928 | hypothetical protein | - |
| NIS64_RS00355 | 58811..58972 | + | 162 | WP_172686697 | TraY domain-containing protein | - |
| NIS64_RS00360 | 59037..59405 | + | 369 | WP_053390195 | type IV conjugative transfer system pilin TraA | - |
| NIS64_RS00365 | 59419..59724 | + | 306 | WP_053390196 | type IV conjugative transfer system protein TraL | traL |
| NIS64_RS00370 | 59744..60310 | + | 567 | WP_053390197 | type IV conjugative transfer system protein TraE | traE |
| NIS64_RS00375 | 60297..61031 | + | 735 | WP_053390198 | type-F conjugative transfer system secretin TraK | traK |
| NIS64_RS00380 | 61031..62452 | + | 1422 | WP_075606927 | F-type conjugal transfer pilus assembly protein TraB | traB |
| NIS64_RS00385 | 62445..63041 | + | 597 | WP_075606926 | conjugal transfer pilus-stabilizing protein TraP | - |
| NIS64_RS00390 | 63064..63633 | + | 570 | WP_075606925 | type IV conjugative transfer system lipoprotein TraV | traV |
| NIS64_RS00395 | 63745..64023 | + | 279 | WP_053390295 | hypothetical protein | - |
| NIS64_RS00400 | 64030..64218 | + | 189 | WP_053390294 | hypothetical protein | - |
| NIS64_RS00405 | 64302..64703 | + | 402 | WP_075606924 | hypothetical protein | - |
| NIS64_RS00410 | 64700..64999 | + | 300 | WP_053390307 | hypothetical protein | - |
| NIS64_RS00415 | 65158..65469 | + | 312 | WP_227524648 | hypothetical protein | - |
| NIS64_RS00420 | 65562..68201 | + | 2640 | WP_075606922 | type IV secretion system protein TraC | virb4 |
| NIS64_RS00425 | 68201..68590 | + | 390 | WP_060415481 | type-F conjugative transfer system protein TrbI | - |
| NIS64_RS00430 | 68587..69213 | + | 627 | WP_060415482 | type-F conjugative transfer system protein TraW | traW |
| NIS64_RS00435 | 69257..70216 | + | 960 | WP_229295972 | conjugal transfer pilus assembly protein TraU | traU |
| NIS64_RS00440 | 70229..70855 | + | 627 | WP_075606921 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| NIS64_RS00445 | 70852..72807 | + | 1956 | WP_075606920 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| NIS64_RS00450 | 72839..73099 | + | 261 | WP_053390216 | hypothetical protein | - |
| NIS64_RS00455 | 73092..73703 | + | 612 | WP_053390217 | hypothetical protein | - |
| NIS64_RS00460 | 73693..73935 | + | 243 | WP_053390218 | conjugal transfer protein TrbE | - |
| NIS64_RS00465 | 73981..74308 | + | 328 | Protein_94 | hypothetical protein | - |
| NIS64_RS00470 | 74329..75081 | + | 753 | WP_053390220 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| NIS64_RS00475 | 75092..75328 | + | 237 | WP_053390221 | type-F conjugative transfer system pilin chaperone TraQ | - |
| NIS64_RS00480 | 75303..75422 | + | 120 | Protein_97 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | - |
| NIS64_RS00485 | 75493..76362 | + | 870 | Protein_98 | type IV secretion system DNA-binding domain-containing protein | - |
| NIS64_RS00490 | 76362..77141 | + | 780 | Protein_99 | MobF family relaxase | - |
| NIS64_RS00495 | 77138..77488 | + | 351 | Protein_100 | fertility inhibition protein FinO | - |
| NIS64_RS00500 | 77638..78429 | + | 792 | WP_075606913 | DsbA family protein | - |
| NIS64_RS00505 | 78559..79155 | + | 597 | WP_042927543 | PIN domain-containing protein | - |
| NIS64_RS00510 | 79225..79869 | + | 645 | WP_042927545 | hypothetical protein | - |
Host bacterium
| ID | 17201 | GenBank | NZ_MZ726784 |
| Plasmid name | p24150-KPC | Incompatibility group | IncFII |
| Plasmid size | 81246 bp | Coordinate of oriT [Strand] | 56951..57000 [-] |
| Host baterium | Raoultella ornithinolytica strain 24150 |
Cargo genes
| Drug resistance gene | blaKPC-2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |