Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116754
Name   oriT_pSD96_09 in_silico
Organism   Lactococcus lactis subsp. lactis bv. diacetylactis strain SD96
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP043521 (1464..1499 [+], 36 nt)
oriT length   36 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 36 nt

>oriT_pSD96_09
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17187 GenBank   NZ_CP043521
Plasmid name   pSD96_09 Incompatibility group   -
Plasmid size   2735 bp Coordinate of oriT [Strand]   1464..1499 [+]
Host baterium   Lactococcus lactis subsp. lactis bv. diacetylactis strain SD96

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -