Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 116732
• Name: oriT_NW116|unnamed
• Organism: Yersinia enterocolitica strain NW116
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP107098 (1553..1610 [-], 58 nt)
• oriT length: 58 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 58 nt

>oriT_NW116|unnamed
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 17165
• GenBank: NZ_CP107098
• Plasmid name: NW116|unnamed
• Incompatibility group: ColRNAI
• Plasmid size: 3300 bp
• Coordinate of oriT [Strand]: 1553..1610 [-]
• Host baterium: Yersinia enterocolitica strain NW116

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -