Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 116730
• Name: oriT_NW117|unnamed2
• Organism: Yersinia enterocolitica strain NW117
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP107107 (467..524 [+], 58 nt)
• oriT length: 58 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 58 nt

>oriT_NW117|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 17163
• GenBank: NZ_CP107107
• Plasmid name: NW117|unnamed2
• Incompatibility group: Col440II
• Plasmid size: 3300 bp
• Coordinate of oriT [Strand]: 467..524 [+]
• Host baterium: Yersinia enterocolitica strain NW117

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -