Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 116707
• Name: oriT_A7|unnamed2
• Organism: Salmonella sp. A7
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP084003 (1055..1111 [+], 57 nt)
• oriT length: 57 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 57 nt

>oriT_A7|unnamed2
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 17140
• GenBank: NZ_CP084003
• Plasmid name: A7|unnamed2
• Incompatibility group: Col440I
• Plasmid size: 2699 bp
• Coordinate of oriT [Strand]: 1055..1111 [+]
• Host baterium: Salmonella sp. A7

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -