Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116707
Name   oriT_A7|unnamed2 in_silico
Organism   Salmonella sp. A7
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP084003 (1055..1111 [+], 57 nt)
oriT length   57 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 57 nt

>oriT_A7|unnamed2
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17140 GenBank   NZ_CP084003
Plasmid name   A7|unnamed2 Incompatibility group   Col440I
Plasmid size   2699 bp Coordinate of oriT [Strand]   1055..1111 [+]
Host baterium   Salmonella sp. A7

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -