Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116618
Name   oriT_FDAARGOS_1499|unnamed in_silico
Organism   Escherichia fergusonii strain FDAARGOS_1499
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP083639 (11192..11290 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_FDAARGOS_1499|unnamed
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   17051 GenBank   NZ_CP083639
Plasmid name   FDAARGOS_1499|unnamed Incompatibility group   IncR
Plasmid size   57214 bp Coordinate of oriT [Strand]   11192..11290 [-]
Host baterium   Escherichia fergusonii strain FDAARGOS_1499

Cargo genes


Drug resistance gene   blaTEM-1B, tet(B), aph(3'')-Ib, aph(6)-Id
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -