Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116513
Name   oriT_6S41-1|p4-6S41-1 in_silico
Organism   Escherichia fergusonii strain 6S41-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP079888 (5448..5507 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_6S41-1|p4-6S41-1
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16946 GenBank   NZ_CP079888
Plasmid name   6S41-1|p4-6S41-1 Incompatibility group   ColRNAI
Plasmid size   9354 bp Coordinate of oriT [Strand]   5448..5507 [+]
Host baterium   Escherichia fergusonii strain 6S41-1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -