Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116483
Name   oriT_pRM2023 in_silico
Organism   Proteus mirabilis strain MoRay12
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP135988 (663..722 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRM2023
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16916 GenBank   NZ_CP135988
Plasmid name   pRM2023 Incompatibility group   ColRNAI
Plasmid size   8419 bp Coordinate of oriT [Strand]   663..722 [-]
Host baterium   Proteus mirabilis strain MoRay12

Cargo genes


Drug resistance gene   aadA1, aph(3')-Ia
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -