Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116387 |
| Name | oriT_pGR-8  |
| Organism | Bacillus safensis strain Ingolstadt |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM008163 (3298..3319 [+], 22 nt) |
| oriT length | 22 nt |
| IRs (inverted repeats) | 1..6, 16..21 (CCCCCC..GGGGGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 22 nt
>oriT_pGR-8
CCCCCCACTCTAACAGGGGGGT
CCCCCCACTCTAACAGGGGGGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16820 | GenBank | NZ_CM008163 |
| Plasmid name | pGR-8 | Incompatibility group | - |
| Plasmid size | 7114 bp | Coordinate of oriT [Strand] | 3298..3319 [+] |
| Host baterium | Bacillus safensis strain Ingolstadt |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |