Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116373 |
| Name | oriT_pK1118-KPC  |
| Organism | Citrobacter koseri strain K1118 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP136822 (52412..52512 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | 80..85, 91..96 (AAAAAA..TTTTTT) 20..26, 38..44 (TAAATCA..TGATTTA) |
| Location of nic site | 62..63 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_pK1118-KPC
TATTTATTTTTTTATCTTTTAAATCAGTATGATAGCGTGATTTATCGCGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
TATTTATTTTTTTATCTTTTAAATCAGTATGATAGCGTGATTTATCGCGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 24587..34912
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| R1015_RS22585 (R1015_22585) | 19814..20359 | + | 546 | WP_001493763 | plasmid pRiA4b ORF-3 family protein | - |
| R1015_RS22590 (R1015_22590) | 20496..21068 | + | 573 | WP_001493762 | recombinase family protein | - |
| R1015_RS22595 (R1015_22595) | 21105..22496 | + | 1392 | WP_014839878 | ISKra4-like element ISKpn19 family transposase | - |
| R1015_RS22600 (R1015_22600) | 22655..23352 | + | 698 | WP_095033700 | IS1-like element IS1B family transposase | - |
| R1015_RS22605 (R1015_22605) | 23593..23880 | + | 288 | Protein_25 | DUF6710 family protein | - |
| R1015_RS22610 (R1015_22610) | 24054..24587 | - | 534 | WP_000792636 | phospholipase D family protein | - |
| R1015_RS22615 (R1015_22615) | 24587..25582 | - | 996 | WP_000128596 | ATPase, T2SS/T4P/T4SS family | virB11 |
| R1015_RS22620 (R1015_22620) | 25624..26784 | - | 1161 | WP_000101710 | type IV secretion system protein VirB10 | virB10 |
| R1015_RS22625 (R1015_22625) | 26784..27668 | - | 885 | WP_000735066 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
| R1015_RS22630 (R1015_22630) | 27679..28377 | - | 699 | WP_000646594 | virB8 family protein | virB8 |
| R1015_RS22635 (R1015_22635) | 28596..29636 | - | 1041 | WP_001749958 | type IV secretion system protein | virB6 |
| R1015_RS22640 (R1015_22640) | 29652..29879 | - | 228 | WP_001749959 | IncN-type entry exclusion lipoprotein EexN | - |
| R1015_RS22645 (R1015_22645) | 29887..30600 | - | 714 | WP_001749960 | type IV secretion system protein | virB5 |
| R1015_RS22650 (R1015_22650) | 30618..33086 | - | 2469 | WP_224743086 | VirB4 family type IV secretion/conjugal transfer ATPase | virb4 |
| R1015_RS22655 (R1015_22655) | 33218..33535 | - | 318 | WP_000496058 | VirB3 family type IV secretion system protein | virB3 |
| R1015_RS22660 (R1015_22660) | 33585..33878 | - | 294 | WP_001749962 | hypothetical protein | virB2 |
| R1015_RS22665 (R1015_22665) | 33888..34169 | - | 282 | WP_000440698 | transcriptional repressor KorA | - |
| R1015_RS22670 (R1015_22670) | 34178..34912 | - | 735 | WP_001749963 | lytic transglycosylase domain-containing protein | virB1 |
| R1015_RS22675 (R1015_22675) | 34976..35326 | + | 351 | WP_024129965 | H-NS family nucleoid-associated regulatory protein | - |
| R1015_RS22680 (R1015_22680) | 35342..35686 | + | 345 | WP_001749964 | hypothetical protein | - |
| R1015_RS22685 (R1015_22685) | 35683..35997 | + | 315 | WP_001749965 | TrbM/KikA/MpfK family conjugal transfer protein | - |
| R1015_RS22690 (R1015_22690) | 36033..36344 | + | 312 | WP_001452736 | hypothetical protein | - |
| R1015_RS22695 (R1015_22695) | 36394..37041 | + | 648 | WP_015344958 | restriction endonuclease | - |
| R1015_RS22700 (R1015_22700) | 37046..37252 | + | 207 | WP_001749967 | hypothetical protein | - |
| R1015_RS22705 (R1015_22705) | 37263..37535 | - | 273 | Protein_45 | IS1 family transposase | - |
| R1015_RS22710 (R1015_22710) | 37634..39067 | + | 1434 | WP_001288432 | DNA cytosine methyltransferase | - |
Host bacterium
| ID | 16806 | GenBank | NZ_CP136822 |
| Plasmid name | pK1118-KPC | Incompatibility group | IncN |
| Plasmid size | 65581 bp | Coordinate of oriT [Strand] | 52412..52512 [+] |
| Host baterium | Citrobacter koseri strain K1118 |
Cargo genes
| Drug resistance gene | blaKPC-2, qnrS1, ARR-3, aac(6')-Ib-cr |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |