Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116344
Name   oriT_KRS02083|unnamed1 in_silico
Organism   Streptococcus parauberis strain KRS02083
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP082784 (1301..1437 [+], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      80..86, 88..94  (CTTTGTA..TACAAAG)
 21..28, 42..49  (AAAAGGGG..CCCCTTTT)
 25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_KRS02083|unnamed1
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACTTTGTAATACAAGAACGAAGTGCTTTGTATTACAAAGTGATAGCTTGCAGTATTTTTTGATTTATATTTGCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16777 GenBank   NZ_CP082784
Plasmid name   KRS02083|unnamed1 Incompatibility group   -
Plasmid size   12659 bp Coordinate of oriT [Strand]   1301..1437 [+]
Host baterium   Streptococcus parauberis strain KRS02083

Cargo genes


Drug resistance gene   tet(S)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -