Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116308
Name   oriT_IVB6232|unnamed2 in_silico
Organism   Staphylococcus aureus strain IVB6232
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP094761 (22061..22247 [+], 187 nt)
oriT length   187 nt
IRs (inverted repeats)      101..106, 110..115  (TCTGGC..GCCAGA)
 58..65, 72..79  (TTTTTATG..CATAAAAA)
 41..46, 48..53  (AAGTGT..ACACTT)
 31..39, 44..52  (AGTGTCACA..TGTGACACT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 187 nt

>oriT_IVB6232|unnamed2
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTAAGCTTTTTATGACCCCACATAAAAATATTGTTGAAGCTTTGAATTGTCTGGCTTTGCCAGATACCCCATGTATACATGGGGTCAAATTTCCCTTATGCTCTTACGGAGTTCTTAGAGGAAAAATAAAAATTCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16741 GenBank   NZ_CP094761
Plasmid name   IVB6232|unnamed2 Incompatibility group   -
Plasmid size   25701 bp Coordinate of oriT [Strand]   22061..22247 [+]
Host baterium   Staphylococcus aureus strain IVB6232

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21