Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116303
Name   oriT_IVB6195|unnamed in_silico
Organism   Staphylococcus aureus strain IVB6195
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP094774 (32602..32788 [-], 187 nt)
oriT length   187 nt
IRs (inverted repeats)      101..106, 110..115  (TCTGGC..GCCAGA)
 58..65, 72..79  (TTTTTATG..CATAAAAA)
 41..46, 48..53  (AAGTGT..ACACTT)
 31..39, 44..52  (AGTGTCACA..TGTGACACT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 187 nt

>oriT_IVB6195|unnamed
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTAAGCTTTTTATGACCCCACATAAAAATATTGTTGAAGCTTTGAATTGTCTGGCTTTGCCAGATACCCCATGTATACATGGGGTCAAATTTCCCTTATGCTCTTACGGAGTTCTTAGAGAAAAAATAAAAATTCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16736 GenBank   NZ_CP094774
Plasmid name   IVB6195|unnamed Incompatibility group   -
Plasmid size   42055 bp Coordinate of oriT [Strand]   32602..32788 [-]
Host baterium   Staphylococcus aureus strain IVB6195

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21