Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116294 |
| Name | oriT_IVB6191|unnamed2  |
| Organism | Staphylococcus aureus strain IVB6191 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP094777 (2632..2809 [+], 178 nt) |
| oriT length | 178 nt |
| IRs (inverted repeats) | 152..157, 167..172 (ATTTTA..TAAAAT) 88..95, 99..106 (TATCTGGC..GCCAGATA) 44..51, 64..71 (GTCTTTTT..AAAAAGAC) 22..28, 33..39 (TGTCACA..TGTGACA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 178 nt
>oriT_IVB6191|unnamed2
TGTGACAAACGCAATATATTGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGGCATATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTGACAAACGCAATATATTGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGGCATATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16727 | GenBank | NZ_CP094777 |
| Plasmid name | IVB6191|unnamed2 | Incompatibility group | - |
| Plasmid size | 3587 bp | Coordinate of oriT [Strand] | 2632..2809 [+] |
| Host baterium | Staphylococcus aureus strain IVB6191 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |