Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116293 |
| Name | oriT_IVB6201|unnamed  |
| Organism | Staphylococcus aureus strain IVB6201 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP094771 (3015..3192 [-], 178 nt) |
| oriT length | 178 nt |
| IRs (inverted repeats) | 152..157, 167..172 (ATTTTA..TAAAAT) 88..95, 99..106 (TATCTGGC..GCCAGATA) 44..51, 64..71 (GTCTTTTT..AAAAAGAC) 22..28, 33..39 (TGTCACA..TGTGACA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 178 nt
>oriT_IVB6201|unnamed
TGTGACAAACGCAATATATTGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGGCATATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTGACAAACGCAATATATTGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGGCATATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16726 | GenBank | NZ_CP094771 |
| Plasmid name | IVB6201|unnamed | Incompatibility group | - |
| Plasmid size | 3783 bp | Coordinate of oriT [Strand] | 3015..3192 [-] |
| Host baterium | Staphylococcus aureus strain IVB6201 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |