Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   116293
Name   oriT_IVB6201|unnamed in_silico
Organism   Staphylococcus aureus strain IVB6201
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP094771 (3015..3192 [-], 178 nt)
oriT length   178 nt
IRs (inverted repeats)      152..157, 167..172  (ATTTTA..TAAAAT)
 88..95, 99..106  (TATCTGGC..GCCAGATA)
 44..51, 64..71  (GTCTTTTT..AAAAAGAC)
 22..28, 33..39  (TGTCACA..TGTGACA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 178 nt

>oriT_IVB6201|unnamed
TGTGACAAACGCAATATATTGTGTCACAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGGCATATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   16726 GenBank   NZ_CP094771
Plasmid name   IVB6201|unnamed Incompatibility group   -
Plasmid size   3783 bp Coordinate of oriT [Strand]   3015..3192 [-]
Host baterium   Staphylococcus aureus strain IVB6201

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -