Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116267 |
| Name | oriT_ES-397|unnamed3  |
| Organism | Enterococcus faecalis strain ES-397 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP136344 (3676..3725 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | 34..35 |
| Conserved sequence flanking the nic site |
GCTTGCAAAA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_ES-397|unnamed3
AATATCGCAACATGGTACCATGTTGCTCCGCTTGCAAAAAGAAAGCCTAC
AATATCGCAACATGGTACCATGTTGCTCCGCTTGCAAAAAGAAAGCCTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16700 | GenBank | NZ_CP136344 |
| Plasmid name | ES-397|unnamed3 | Incompatibility group | - |
| Plasmid size | 45375 bp | Coordinate of oriT [Strand] | 3676..3725 [-] |
| Host baterium | Enterococcus faecalis strain ES-397 |
Cargo genes
| Drug resistance gene | aac(6')-aph(2''), erm(B), dfrG |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |