Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 116248 |
| Name | oriT_pEr983-2  |
| Organism | Enterobacter roggenkampii isolate enterobacter cloacae |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP060739 (15737..15834 [+], 98 nt) |
| oriT length | 98 nt |
| IRs (inverted repeats) | 76..81, 88..93 (AAAAAA..TTTTTT) 76..81, 87..92 (AAAAAA..TTTTTT) 30..37, 40..47 (AGCGTGAT..ATCACGCT) 2..7, 17..22 (TTATTT..AAATAA) |
| Location of nic site | 58..59 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 98 nt
>oriT_pEr983-2
TTTATTTTTTTCTTTTAAATAAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTATTTTTTTCTTTTAAATAAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 16681 | GenBank | NZ_CP060739 |
| Plasmid name | pEr983-2 | Incompatibility group | IncFIA |
| Plasmid size | 27019 bp | Coordinate of oriT [Strand] | 15737..15834 [+] |
| Host baterium | Enterobacter roggenkampii isolate enterobacter cloacae |
Cargo genes
| Drug resistance gene | blaTEM-1B |
| Virulence gene | manC, manB |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |